Mice

CLR KO mice used in this study are shown in Table 1. Dectin-1 KO mice [14] generated on a 129 background were backcrossed for a total of 11 generations to the C57BL6/J background. Mincle KO mice [25] were obtained from the Mutant Mouse Resource and Research Center (MMRRC). Dectin-2 KO mice [7] were sourced from Tokyo University of Science. As the Dectin-2 gene cluster (Clec4n, Clec4d and Clec4e) and Dectin-1 (Clec7a) are located on mouse chromosome 6, ~6cM apart (S1 Fig), a unique targeting strategy involving cross-breeding to identify rare recombination events and Crispr-Cas9 technology was employed to generate double (DKO) and triple (TKO) KO mice. The various multi-CLR KO mouse strains were then bred to homozygosity. Mincle-Dectin-1 DKO1 mice were generated by crossing Mincle KO with Dectin-1 KO mice. Sigma Advanced Genetic Engineering (SAGE) generated Mincle-Dectin-2 DKO2 mice by targeting Dectin-2 in Mincle KO mice using Crispr-Cas9 technology. Briefly, SAGE designed donor plasmids with homologous arms and an insert sequence containing 3-frame stop codons upstream of a LoxP site. The following sequence (GAGTGACTGATAACTTCGTATAGCATACATTATACGAAGTTATCGAT) was inserted into exon 3 of Clec4n (Dectin-2) in Mincle KO mice (S1 Fig). Dectin-1-Dectin-2 DKO mice were generated by crossing Dectin-1 KO with Dectin-2 KO mice. Mincle-Dectin-2-Dectin-1 TKO1 mice were generated by crossing Mincle-Dectin-2 DKO2 mice with Dectin-1 mice (Table 1). Mice were age and gender matched for experiments. Female mice were co-housed for 1–3 weeks prior to in vivo experiments. For various experiments where male mice were used, bedding was swapped between cages for 3–7 days prior to experiments.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 1. CLR KO mice used in this study.

https://doi.org/10.1371/journal.ppat.1007850.t001

Ethics

The mice were maintained and handled according to institutional and UK Home Office guidelines. This study was performed in strict accordance with the Project License (30/2938, P05D6A456) and procedures that were approved by Cardiff University Animal Welfare and Ethical Review Body and the UK Home Office. The animal care and use protocol adhered to the Animals (Scientific Procedures) Act 1986.

Reagents

Flow cytometry antibodies against Ly6C, Ly6G, CD11b, F4/80, CD11c, MHCII, B220, CD19, CD3, CD4, CD8, CD49b, TLR2, TLR4, mannose receptor (MR), IFN-γ, IL-17, TNF and isotype controls were purchased from Biolegend. Dectin-1 antibody (AbD Serotec), Dectin-2 antibody D2.11E4 [32] and Mincle/Clec4e antibody (Abnova) were used in this study. IFN-γ, IL-17, G-CSF, MIP2, MIP1α and MCP1 ELISAs were purchased from R&D while IL-1β, IL-6, IL-10, IL-12p40 and TNF ELISAs were purchased from Invitrogen.

Candida culture

Candida albicans SC5314 (ATCC) was plated on YPD agar, cultured for 16–20 h in YPD broth, washed three times with PBS and resuspended at the required concentration in PBS.

In vivo Systemic Candida infections

Age matched (8–12 weeks old) female mice were injected i.v. with 100μl of C. albicans in PBS. Mice were monitored and weighed daily. Experiments were continued for a maximum of 30 days post-infection. Kidneys, brains and spleens were harvested. The left kidney was placed in PBS, homogenised and serial dilutions were plated on YPD agar containing 50μg/ml chloramphenicol. The plates were cultured for 24 h and CFU were calculated per g organ. Alternatively, the left kidney was diced into small pieces, incubated at 37°C for 30 min in DMEM/F12 medium (Gibco) including 0.2mg/ml Liberase TL (Roche) and 100U/ml DNase I (Invitrogen). Following digestion, DMEM/F12 medium containing 10% fetal bovine serum (FBS) was added, filtered through 40μm cell strainers (BD) and then centrifuged at 4°C, 500g for 5 min. The pellet was resuspended with ice-cold PBS as a single cell suspension for further staining procedures. The right kidney was placed in 10% formalin, embedded in paraffin wax blocks, processed using an automated tissue processor, sectioned at 4μm, deparaffinised and stained for H&E and PAS according to standard protocols. The spleens were homogenized, red blood cells were lysed with ACK lysis buffer and the cells were washed with PBS and IMDM. Cells were resuspended in IMDM containing 10% FBS, 2mM L-glutamine, penicillin/streptomycin, 50μM 2-mercaptoethanol plated and restimulated with C. albicans for 48 h in the presence of Amphotericin B or with PMA (50ng/ml) and Ionomycin (0.5μg/ml) in the presence of 0.2% Brefeldin A for 4 h. IFN-γ and IL-17 levels were measured by ELISA in C. albicans-stimulated cells while PMA/Ionomycin-induced IFN-γ and IL-17A producing cells were analysed by flow cytometry. Alternatively, the splenocytes were fixed in 1% paraformaldehyde for 20 min after the red blood lysis and the PBS wash. The cells were centrifuged and resuspended in PBS. The cells were then stained with antibodies for myeloid cell markers and analysed by flow cytometry.

Histology Scoring

Kidneys were examined at 4μm and the cortex and medulla individually assessed for the presence of inflammatory cells including neutrophils and lymphocytes / plasma cells and scored as follows: Score 0 = no inflammation, Score 1 = < 3 foci of inflammation, Score 2 = 4 to 6 foci of inflammation, Score 3 = > 6 foci of inflammation, but less than 25% of kidney affected, Score 4 = > 25% of kidney affected. Scoring was performed by a pathologist blinded to the experimental groups.

Primary myeloid cells

To recruit primary myeloid cells, mice were injected intraperitoneally with 0.5ml 2% (w/v) BIOgel P-100 polyacrylamide beads (BIO-Rad), 16–18 h prior to peritoneal lavage. Inflammatory cells were collected after sacrifice by peritoneal lavage with ice-cold RPMI containing 10% FBS and 1% penicillin/streptomycin. To remove BIOgel beads from cells, the cells were filtered through 40μm cell strainers. Cells were washed twice with RPMI containing 10% FBS and 1% penicillin/streptomycin.

Fluorescent labelling of C. albicans

C. albicans was washed three times with PBS and resuspended at 1x10⁸/ml in PBS. Candida was labelled with cell trace far red (Invitrogen) at a concentration of 3.4μg/ml for 30 min while rotating at RT. Candida was washed three times with PBS and resuspended at the desired concentration in RPMI containing 10% FBS and 1% penicillin/streptomycin.

C. albicans recognition and dihydrorhodamine 123 ROS assay

4x10⁵ BIOgel recruited inflammatory cells were plated in 100μl RPMI containing 10% FBS and 1% penicillin/streptomycin in ultra-low attachment 96 well round bottom plates. 4x10⁵ cell trace far red labelled C. albicans in 100μl RPMI containing 10% FBS and 1% penicillin/streptomycin were added to the inflammatory cells and incubated at 37°C for 15 min. Cells were centrifuged and supernatants were removed. 100μl of 5μM dihydrorhodamine 123 (DHR-123) (Invitrogen) in warmed PBS was added to cells and incubated at 37°C for 15 min. Cells were centrifuged, supernatants were removed, and cells were washed once with ice-cold PBS. Cells were stained with antibodies for Ly6G and CD11b and analysed by flow cytometry or Amnis Imagestream^x MkII.

Luminol ROS assay and candidacidal assay

BIOgel recruited inflammatory cells were recovered by peritoneal lavage and washed as described above. Cells were stained with antibodies against Ly6G, CD19 and CD11b. Ly6G^-CD11b⁺CD19^- inflammatory monocytes/macrophages and Ly6G⁺CD11b⁺CD19^- neutrophils were purified by cell sorting on a FACS Aria cell sorter.

To opsonise C. albicans, 5x10⁷ C. albicans were placed in a 1.5ml Eppendorf tube and resuspended in 200μl mouse serum. This was incubated at 37°C for 15 min with frequent mixing. Opsonised C. albicans was washed 3x with PBS prior to use.

For the luminol assay, purified cells were seeded at 1x10⁵ cells per well in a 96-well luminescence plate in 100μl DMEM with no phenol red containing 10% FBS, 2mM L-glutamine and 800μM luminol. The plate was incubated for 30 min at 37°C, after which 100μl media, 1x10⁵ C. albicans, opsonised C. albicans or PMA (400ng/ml) was added. The plate was immediately placed in a luminescence plate reader at 37°C and luminescence readings were measured every 8.7 min for 3.5 h.

For the candidacidal assay, purified cells were seeded at 1x10⁵ cells per well in a 96-well round bottom plate in 100μl DMEM with no phenol red containing 10% FBS and 2mM L-glutamine. 100μl media, 1x10⁵ C. albicans or opsonised C. albicans was added. The plate was incubated for 3 h at 37°C. Cells were lysed with 200μl 1% Triton X-100, and Candida were plated on YPD agar and incubated at 37°C for 24 h. The percentage of Candida killed by monocytes/macrophages or neutrophils was determined by [1-(number of C. albicans incubated with cells)/(number of C. albicans incubated without cells)]x100.

C. albicans-induced intracellular cytokine

4x10⁵ BIOgel recruited inflammatory cells were plated in 100μl RPMI containing 10% FBS and 1% penicillin/streptomycin in ultra low attachment 96 well round bottom plates. 4x10⁵ cell trace far red labelled C. albicans in 100μl RPMI containing 10% FBS and 1% penicillin/streptomycin were added to the inflammatory cells and incubated at 37°C for 3 h in the presence of 0.2% Brefeldin A. Cells were stained with live/dead fixable aqua dead cell stain kit (Invitrogen), antibodies against Ly6G, CD11b and CD19 and intracellular TNF levels were measured by flow cytometry.

C. albicans recognition and internalisation

BIOgel recruited inflammatory cells were stained with antibodies against Ly6G and CD11b. Cells and cell trace far red labelled C. albicans were mixed at 1:1 ratio and analysed by Amnis Imagestream^x MkII over 1.5 h at RT. An object mask on CD11b and a morphology mask on C. albicans was applied on pre-gated neutrophils or monocytes which were best in focus (Gradient RMS_M01_BRF) using Ideas software 6.2. An internalisation feature was used [Internalisation_Object(M02, CD11b, Tight)_C. albicans] to differentiate between cells that had internalised C. albicans versus cells that had C. albicans bound externally.

RNAseq

BIOgel recruited inflammatory cells were recovered by peritoneal lavage and washed as described above. Cells were stained with antibodies against Ly6G, CD4, CD8, Ly6C, F4/80, CD19, DX5 and CD11b. Ly6C^hiLy6G^-CD11b⁺F4/80⁺CD4^-CD8^-DX5^-CD19^- inflammatory monocytes were purified by cell sorting on a FACS Aria cell sorter. Inflammatory monocytes were incubated at 37°C with C. albicans at 3:1 Cells:Candida ratio for 3 h in RPMI containing 10% FBS, 1% penicillin/streptomycin, 1% L-glutamine, 0.5% HEPES and 50μM 2-mercaptoethanol. Cell pellets were snap frozen and stored in -80°C. RNA was extracted using a RNeasy mini kit (Qiagen). Total RNA quality and quantity was assessed using Agilent 2100 Bioanalyser and a RNA Nano 6000 kit (Agilent Technologies). Total RNA with a RIN value >7 was depleted of ribosomal RNA using the NEBNext rRNA Depletion Kit (Human/Mouse/Rat), (New England BioLabs, NEB) and the sequencing libraries were prepared using the NEB Ultra II Directional RNA Library Prep Kit for Illumina (NEB). Libraries were normalised to 10nM, pooled and sequenced using a 75-base paired-end (2x75bp PE) dual index read format on the Illumina HiSeq4000 according to the manufacturer’s instructions. Reads from sequencing were trimmed with Trimmomatic [33] and assessed for quality using FastQC (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/), using default parameters. Reads were mapped to the mouse GRCm38 reference genome using STAR [34] and counts were assigned to transcripts using featureCounts [35] using the GRCm38.84 Ensembl gene build GTF. Both the reference genome and GTF were downloaded from the Ensembl FTP site (http://www.ensembl.org/info/data/ftp/index.html/). RNAseq data has been deposited to ArrayExpress (https://www.ebi.ac.uk/arrayexpress/) under accession number E-MTAB-8030. Differential gene expression analyses used the DESeq2 Bioconductor package [36]. Genes were filtered from the analysis where read count < 10 over all replicates and conditions. Normalised gene expression values (FPKM), used for downstream cluster analysis, were calculated for all significantly differentially expressed genes (significance: adjusted p value < 0.05, Benjamini-Hochberg correction for multiple testing). Cluster analysis were performed in Genesis [37] where FPKM count data were z-score transformed over genes. Pathway term-enrichment analyses of each cluster was performed in Ingenuity IPA (QIAGEN: Inc. https://www.qiagenbioinformatics.com/products/ingenuity-pathway-analysis)

Cytokine/Chemokine assays

Bone marrow cells were flushed out of the femurs and tibiae of mice. Red blood cells were lysed with ACK lysis buffer and the cells were washed with PBS. Monocytes were magnetically sorted using a negative selection bone marrow monocyte isolation kit. Cells were incubated with C. albicans at 3:1 Cells:Candida ratio for 24 h. 2.5μg/ml Amphotericin B was added 2 h after stimulation. Cell culture supernatants were recovered and assayed for cytokine/chemokine by ELISA (Invitrogen/R&D).

In vivo Peritoneal C. albicans infections

Age matched male mice were injected i.p. with 1x10⁵ CFU of C. albicans in 100μl PBS, 4 h prior to peritoneal lavage. Inflammatory cells were collected after sacrifice by peritoneal lavage with 1ml ice-cold PBS. Cells were counted using a MUSE cell counter, cells were centrifuged and lavage fluid was removed and placed in a fresh 1.5ml eppendorf tube and frozen at -80°C. Cells were stained with antibodies against Ly6G, Ly6C, CD11b, F4/80, CD11c, MHCII and CD19. Myeloid cell recruitment was measured by flow cytometry. Cytokine/chemokine levels in the lavage fluid were measured by ELISA.

Adoptive transfer

Bone marrow cells were flushed out of the femurs and tibiae of mice. Red blood cells were lysed with ACK lysis buffer and the cells were washed with PBS. Monocytes were magnetically sorted using a negative selection bone marrow monocyte isolation kit. Monocytes were further purified to Ly6C^hiLy6G^-CD11b⁺CD4^-CD8^-CD19^-CD49b^-Cd11c^- cells by FACS sorting on a FACS Aria cell sorter. Cells were 93–99% viable post-sort. 3-4x10⁶ Ly6C^hi monocytes from wildtype (WT) or Min-D2-D1 TKO1 mice were injected intravenously into Ccr2 KO mice followed by i.v. injection of 1.5x10⁵ CFU of C. albicans in PBS. Mice were weighed and monitored daily for 3 days. Kidneys and brains were placed in PBS, homogenised and serial dilutions were plated on YPD agar containing 50μg/ml chloramphenicol. The plates were cultured for 24 h and CFU were calculated per g organ.

Adoptive transfer of labelled cells

Bone marrow cells were flushed out of the femurs and tibiae of mice. Red blood cells were lysed with ACK lysis buffer and the cells were washed with PBS. Monocytes were magnetically sorted using a negative selection bone marrow monocyte isolation kit. Cells were labelled with 5μM CFSE in PBS containing 0.1% BSA for 10 min at 37°C. RPMI containing 10% FBS was added to the cells and cells were incubated on ice for 5 min. Cells were washed with PBS and 2.5x10⁶ monocytes from WT or Min-D2-D1 TKO1 mice were injected intravenously into Ccr2 KO mice followed by i.v. injection of 1.5x10⁵ CFU of C. albicans in PBS. After 24 h, kidneys were placed in PBS. The left kidney was diced into small pieces, incubated at 37°C for 30 min in DMEM/F12 medium including 0.2mg/ml Liberase TL and 100U/ml DNase I. Following digestion, DMEM/F12 medium containing 10% FBS was added, filtered through 40μm cell strainers and then centrifuged at 4°C, 500g for 5 min. The pellet was resuspended with ice-cold PBS as a single cell suspension for further staining procedures. The right kidney was homogenised and serial dilutions were plated on YPD agar containing 50μg/ml chloramphenicol. The plates were cultured for 24 h and CFU were calculated per g organ. Chemokine levels in the kidney homogenates were determined by ELISA.

Statistical Methods

Data are presented as means +/- s.e.m. and are representative or cumulative data from the indicated number of independent experiments. Data was tested for normality and if data followed a Gaussian distribution then one-way ANOVA followed by Bonferroni’s post-test or 2-way ANOVA was used for statistical analysis when multiple groups were analysed or Student’s t test was used for statistical analysis when two groups were analysed. A Gaussian distribution was assumed for experiments with small sample numbers. When data did not follow a Gaussian distribution, it was transformed by Y = sqrt(Y+0.5) for data containing zeros or by Y = logY for other data [38] and analysed by Student’s t test or one-way ANOVA followed by Bonferroni’s post-test if it then followed a Gaussian distribution. If data still did not follow a Gaussian distribution it was analysed by non-parametric Mann-Whitney test or Kruskal-Wallis test followed by Dunn’s post-test. Statistical significance was set at *p<0.05 **p<0.005 ***p<0.001.

Multi-CLR KO mice are dramatically susceptible to C. albicans infection

As Dectin-1, Dectin-2 and Mincle have individually been proposed to play roles in response to C. albicans [7, 14, 25], we aimed to identify collaborative and redundant roles of these CLRs. To this end we generated mice deficient in different combinations of these CLRs (Table 1). We confirmed appropriate loss of CLR protein expression in bone marrow derived dendritic cells (BMDCs) (S1 Fig), inflammatory monocytes/macrophages (S1 Fig) and neutrophils (S1 Fig) from the multi-CLR KO mice generated in this study. Inflammatory monocytes/macrophages displayed higher expression of Dectin-1 and Dectin-2 than neutrophils while Mincle expression was higher on neutrophils (S1 Fig). As expected, expression of additional receptors such as MR, TLR2, TLR4 and CD14 was unaffected on inflammatory monocytes/macrophages from the various multi-CLR KO mice (S1 Fig). The multi-CLR KO mice were viable, had no gross abnormalities and had normal differential splenocyte counts (S1 Table).

In order to determine the collective and contributing roles of these three CLRs during systemic infection with C. albicans, we injected groups of WT and multi-CLR KO mice intravenously with low (1.5x10⁴ CFU), medium (5x10⁴ CFU) or high (1.5x10⁵ CFU) doses of C. albicans SC5314. Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 mice displayed marked susceptibility to systemic infection with C. albicans with both medium (Fig 1A) and high (Fig 1B) dose infection. All Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 mice infected with a medium or high dose of C. albicans succumbed to the infection by day 6 (by humane end-point) and some Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 mice infected with a low dose of C. albicans even succumbed within 6 days of infection (Fig 1C). Dectin-1 and Mincle-Dectin-1 DKO1 mice showed significant susceptibility to systemic infection with C. albicans with both medium (Fig 1A) and high (Fig 1B) dose, however this effect was much less profound than that observed in Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 mice. Dectin-2 and Mincle-Dectin-2 DKO2 mice only showed increased susceptibility to systemic infection with C. albicans with high dose infection (Fig 1B) but not with medium dose infection (Fig 1A). In comparison, Mincle KO mice did not show substantial susceptibility to systemic infection with C. albicans with any of the tested doses (Fig 1A and 1B). The CLR KO mice with highest susceptibility (Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1) to systemic infection with C. albicans (Fig 1A and 1B) displayed the highest fungal burden in the kidneys and brains with low dose infection 6–7 days post-infection (Fig 1C and 1D). Similar effects were observed in mice infected with medium dose (S2 Fig) or high dose (S2 Fig) infection at humane end point or 30 days post-infection. Nodules of Candida were visibly evident on the kidneys of Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 mice (Fig 1E). These data indicate that of the single KO mice, Dectin-1 is most important for C. albicans clearance followed by Dectin-2, and loss of both of these receptors severely diminishes control of systemic C. albicans infection. Mincle deficiency alone or in combination with Dectin-1, Dectin-2 or Dectin-1 and Dectin-2 had limited impact indicating that Mincle is dispensable for clearance of systemic infection.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. Multi-CLR KO mice are dramatically susceptible to C. albicans infection.

(A-B) Survival curves based on humane end point of WT and multi-CLR KO mice infected intravenously with 5x10⁴ CFU (A) or 1.5x10⁵ CFU (B) C. albicans SC5314. Graphs show cumulative data from 7 (A) or 6 (B) independent experiments. The total number of mice and p values for survival curves of CLR KO mice compared to WT mice by log-rank test are shown in the tables opposite each graph. (C-D) Quantification of fungal burden in the kidneys (left) or brains (right) of WT and multi-CLR KO mice 7 days (C) or 6 days (D) after intravenous infection with 1.5x10⁴ CFU C. albicans. Graphs display cumulative data from 3 (C) or 2 (D) independent experiments. Each symbol represents one mouse. Two Mincle-Dectin-2-Dectin-1 TKO1 mice had to be taken on day 6 post-infection (C). The symbols for these two mice have a black outline. (Kruskal-Wallis test with Dunn’s post-test on transformed data). (E) Photograph of representative kidneys from WT and multi-CLR KO mice 6 days after intravenous infection with 1.5x10⁴ CFU C. albicans.

https://doi.org/10.1371/journal.ppat.1007850.g001

C. albicans-infected multi-CLR KO mice display enhanced inflammation in association with uncontrolled fungal burden

As the Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 mice displayed increased susceptibility to systemic C. albicans infection and increased fungal burden, we next examined immune cell recruitment to the kidneys of these mice. We observed increased numbers of myeloid cells including Ly6C^hi monocytes/macrophages and neutrophils in the kidneys of Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 mice compared to WT mice as early as 20 h post-infection (S3 Fig) and also at 4 days post-infection (Fig 2A). In agreement with this, the total number of CD45⁺ cells was increased in the kidneys of the multi-CLR KO mice compared to WT mice (Fig 2B). By day 6 post-infection, we observed that WT mice almost completely cleared low dose C. albicans from their kidneys while Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 mice displayed large areas/abscesses of Candida growth, sometimes in hyphal form (Fig 2C–2E). While kidneys from WT mice displayed limited and predominantly dispersed chronic inflammation with sparse neutrophils 6 days post-infection, kidneys from Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 mice displayed extensive mixed inflammation affecting the cortex, medulla and renal pelvis with focal extension into surrounding adipose tissue (Fig 2F–2H). These multi-CLR KO kidneys showed multi-focal suppurative granulomatous inflammation containing central neutrophilic microabscesses with frequent Candida identification, surrounded by macrophages and chronic inflammatory cells. In some multi-CLR KO cases, occasional kidneys developed cystic degeneration.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. C. albicans-infected multi-CLR KO mice display enhanced inflammation in association with uncontrolled fungal burden.

(A) Total myeloid cell numbers in the CD45⁺ cells and (B) total CD45⁺ cells from kidneys of WT and multi-CLR KO mice 4 days post-infection with 1.5x10⁴ CFU C. albicans were quantified by flow cytometry. Graphs display the cumulative data from 2 independent experiments. Each symbol represents an individual mouse. (1-way ANOVA with Bonferroni’s post-test, Total neutrophils: Kruskal-Wallis test with Dunn’s post-test). (C-D, E-F) Representative WT (left panels), D1-D2 DKO (middle panels) and Min-D2-D1 TKO1 (right panels) kidneys, 6 days after i.v. infection with 1.5x10⁴ CFU C. albicans. (C-D) Kidney sections were stained with Periodic acid Schiff reagent or (E-F) hematoxylin and eosin. Images shown are 4x magnification (C & F) and 20x magnification (D & G). Graphs display Candida area (μm) (E) and clinical score (H). Graphs are the cumulative result of 2 independent experiments. Each symbol represents an individual mouse. (1-way ANOVA with Bonferroni’s post-test: Performed on transformed data for Candida area).

https://doi.org/10.1371/journal.ppat.1007850.g002

Similarly, at 4 days post-infection, we observed increased numbers of splenic myeloid cell populations including Ly6C^hi monocytes and neutrophils and total splenocytes in the susceptible mice strains compared to WT mice (S4 Fig). By 6 days post-infection, splenocyte numbers in the multi-CLR KO mice continued to increase compared to WT mice (S4 Fig). This was not observed in the other single or double KO strains (S4 Fig). At 6 days post-infection the total number of T cells, CD8⁺ T cells and/or NK cells were also increased in these multi-CLR KO mice (S4 Fig). We then restimulated splenocytes from these infected mice with PMA and Ionomycin, to examine the ability of these cells to produce IFN-γ and IL-17. This mainly induced an IFN-γ response with a much smaller IL-17 response. Due to the splenomegaly in Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 mice, the total number of IFN-γ producing cells were increased (S4 Fig). Upon restimulation of the splenocytes with live C. albicans, the multi-CLR KO mice displayed a trend towards increased IFN-γ production although this did not always reach significance (S4 Fig).

These kidney and splenic data indicate that uncontrolled fungal growth in Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 mice is associated with persistent/prolonged inflammatory cell recruitment which may contribute to tissue immunopathology and organ failure.

CLR collaboration mediates C. albicans recognition by inflammatory monocytes/macrophages but not neutrophils

As inflammatory monocytes, macrophages and neutrophils contribute to protection during the early stages of systemic infection with C. albicans [39, 40], we examined the collective and contributing roles of Dectin-1, Dectin-2 and Mincle to C. albicans recognition by myeloid cells. BIOgel polyacrylamide beads were injected intraperitoneally to elucidate inflammatory myeloid cells including neutrophils and monocytes/macrophages [41]. The different KO strains demonstrated similar recruitment of inflammatory monocytes/macrophages (Fig 3A) and neutrophils (Fig 3B) in response to BIOgel. These cells were recovered from the peritoneal cavity of WT and multi-CLR KO mice and incubated ex vivo with cell trace far red-labelled live C. albicans. The percentage of inflammatory monocytes/macrophages (Ly6G^-CD11b⁺) and neutrophils (Ly6G⁺CD11b⁺) interacting with C. albicans were measured by flow cytometry. The inflammatory monocyte/macrophage cell population is Ly6G^-CD11b⁺Ly6C^hi/loF4-80⁺ (S5 Fig). Inflammatory monocytes/macrophages lacking Dectin-1, Dectin-2 or Mincle individually showed no major defects in C. albicans recognition after 15 min incubation. However, inflammatory monocytes/macrophages lacking any two or all three of these CLRs showed significant defects in C. albicans recognition/binding compared to WT cells (Fig 3C and S5 Fig). In addition, Mincle-Dectin-2 DKO2 cells, Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 inflammatory monocytes/macrophages showed significant defects in C. albicans binding compared to Dectin-2 KO cells, while Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 inflammatory monocytes/macrophages showed significant defects in C. albicans binding compared to Dectin-1 KO cells (Fig 3C). In contrast, neutrophils deficient in expression of individual or multiple CLRs showed no major defects in C. albicans binding (Fig 3D and S5 Fig) suggesting the involvement of additional receptors. Using an Amnis Imagestream^x MkII, we confirmed a similar trend towards reduced recognition and internalisation of C. albicans by Mincle-Dectin-2-Dectin-1 TKO1 inflammatory monocytes/macrophages over 1.5 h (Fig 3E and S6 Fig). In addition, we found that the mean number of C. albicans yeast particles internalised per WT inflammatory monocyte/macrophage is ~4 times greater than the mean number of C. albicans yeast particles internalised per Mincle-Dectin-2-Dectin-1 TKO1 inflammatory monocyte/macrophage (Fig 3E). However, no major differences were found for recognition or internalisation by neutrophils (Fig 3F and S6 Fig). Some of the differences between inflammatory monocytes/macrophages and neutrophils are likely due to differences in expression of the CLRs (S1 Fig) and other receptors between these cell types. These data indicate that while Mincle is not required for clearance of C. albicans in vivo, it still contributes to recognition of C. albicans by inflammatory monocytes/macrophages in addition to the main CLRs, Dectin-1 and Dectin-2, while additional receptors are likely to be important for this function in neutrophils.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. CLR collaboration mediates C. albicans recognition by inflammatory monocytes/macrophages but not neutrophils.

(A-F) WT and CLR KO mice were injected with BIOgel i.p. and inflammatory cells were recovered by peritoneal lavage after 16–18 h. (A-D) Cells were stimulated for 15 min at 37°C with cell trace far red-labelled C. albicans at a 1:1 ratio. Cells were stained with anti-Ly6G and anti-CD11b. (A-B) Graphs display % recruited Ly6G^-CD11b⁺ inflammatory monocytes/macrophages (A) and % Ly6G⁺CD11b⁺ neutrophils (B) in the peritoneal cavity 16–18 h after BIOgel injection. (1-way ANOVA with Bonferroni’s post-test: Performed on transformed data for Inflammatory monocytes/macrophages) (C) Ly6G^-CD11b⁺ inflammatory monocytes/macrophages and (D) Ly6G⁺CD11b⁺ neutrophils that interacted with C. albicans were measured by flow cytometry. Percentage WT cells that recognised C. albicans was set at 100%. n = 7–16 mice. Graphs show cumulative data from 8 independent experiments. (Inflammatory monocytes/macrophages: Kruskal-Wallis test with Dunn’s post-test; Neutrophils: 1-way ANOVA with Bonferroni’s post-test). * compared to WT, √ compared to Mincle KO, $ compared to Dectin-1 KO, # compared to Dectin-2 KO (E-F) WT and Min-D2-D1 TKO1 cells were stained with anti-Ly6G and anti-CD11b. Cells were stimulated with cell trace far red-labelled C. albicans at a 1:1 ratio for 1.5 h and analysed by image flow cytometry (Amnis Imagestream^x MkII) for the course of the 1.5 h stimulation at room temperature. Inflammatory monocytes/macrophages (E) and neutrophils (F) that interacted with labelled C. albicans, internalised C. albicans and the mean number of objects internalised per cell that recognised C. albicans were quantified. n = 3 mice. (Student’s paired t test: % Inflam mono/mac recognising C. albicans on normalised data). (E-F) Graphs show the cumulative results from 3 independent experiments.

https://doi.org/10.1371/journal.ppat.1007850.g003

Monocytes/macrophages and neutrophils display limited dependence on CLRs for ROS production

ROS production is considered important for protecting against Candida infections [42]. Therefore, we also examined the collective and contributing roles of Dectin-1, Dectin-2 and Mincle to C. albicans-induced ROS production by inflammatory monocytes/macrophages and neutrophils. We found that cells lacking Dectin-1, Dectin-2 or Mincle individually showed no major defects in C. albicans-induced ROS production by measuring Dihydrorhodamine 123 (DHR-123) fluorescence. However, inflammatory monocytes/macrophages lacking two or all three of these CLRs showed significant defects in C. albicans-induced ROS production (Fig 4A and 4B and S5 Fig). Dectin-1 KO neutrophils displayed a moderate reduction in C. albicans-induced ROS production however, additional loss of Mincle or Dectin-2 did not substantially increase this defect (Fig 4C and 4D and S5 Fig). As DHR-123 fluorescence only measures some reactive oxygen species (hydrogen peroxide, hypochlorous acid, peroxynitrite anion), we also purified the BIOgel-elicited inflammatory monocyte/macrophage and neutrophil populations from WT and Mincle-Dectin-2-Dectin-1 TKO1 mice to measure a broader spectrum of reactive oxygen species using a luminol assay. Using this assay, we did not observe any significant defects in ROS production by Mincle-Dectin-2-Dectin-1 TKO1 monocytes/macrophages (Fig 4E) or neutrophils (Fig 4F). We next measured the ability of WT and Mincle-Dectin-2-Dectin-1 TKO1 monocytes/macrophages and neutrophils to kill C. albicans and opsonised C. albicans. We did not observe any significant defect in the candidacidal ability of the multi-CLR KO cells (Fig 4G and 4H). These data indicate that while these CLRs minimally contribute to C. albicans-mediated induction of some specific reactive oxygen species, ROS production in general and Candida killing are largely independent of these CLRs.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Monocytes/macrophages and neutrophils display limited dependence on CLRs for ROS production.

(A-D) WT and CLR KO mice were injected with BIOgel i.p. and inflammatory cells were recovered by peritoneal lavage after 16–18 h. Cells were stimulated for 15 min with cell trace far red-labelled C. albicans at a 1:1 ratio. Cells were loaded with the ROS indicator Dihydrorhodamine 123 (DHR-123) and stained with anti-Ly6G and anti-CD11b. (A & C) ROS production (DHR-123) was measured by flow cytometry in inflammatory monocytes/macrophages (A) and neutrophils (C) that interacted with labelled C. albicans. DHR-123 MFI for WT cells interacting with C. albicans was set at 100%. n = 7–16 mice. Graphs show cumulative data from 8 independent experiments. (Inflammatory monocytes/macrophages: 1-way ANOVA with Bonferroni’s post-test; Neutrophils: Kruskal-Wallis test with Dunn’s post-test). * compared to WT, √ compared to Mincle KO, $ compared to Dectin-1 KO, # compared to Dectin-2 KO, € compared to MincleDectin-2 DKO2 (B & D) ROS (DHR-123) was measured by image flow cytometry (Amnis Imagestream^x MkII) in inflammatory monocytes/macrophages (B) and neutrophils (D) that interacted with labelled C. albicans. Representative images from 3 independent experiments are shown. BRF = Brightfield. Merged lane consists of CD11b, C. albicans and DHR-123. Ly6G is not included in the merged lane. (E-H) WT and CLR KO mice were injected with BIOgel i.p. and inflammatory cells were recovered by peritoneal lavage after 16–18 h and Ly6G^-CD11b⁺ inflammatory monocytes/macrophages and Ly6G⁺CD11b⁺ neutrophils were purified. (E-F) Purified cell populations were incubated with luminol for 30 min and stimulated with C. albicans, opsonised C. albicans or PMA immediately prior to measurement of luminol luminescence for the shown timecourse. Graphs show cumulative data from 3 independent experiments. (1-way ANOVA with Bonferroni’s post-test on area under the curve). (G-H) Purified Ly6G^-CD11b⁺ inflammatory monocytes/macrophages and Ly6G⁺CD11b⁺ neutrophils were incubated with C. albicans. Cells were lysed after 3 h and candidacidal activity was analysed by measuring CFU in cell lysates. Graphs display cumulative data from 3 independent experiments. (2-way ANOVA with Bonferroni’s post-test).

https://doi.org/10.1371/journal.ppat.1007850.g004

CLR collaboration mediates C. albicans-induced cytokine/chemokine production from inflammatory monocytes/macrophages

As cytokine production is important for the clearance of systemic C. albicans infections [43], we examined TNF production from monocytes/macrophages in response to C. albicans. Inflammatory myeloid cells recovered after BIOgel injection into WT and multi-CLR KO mice were incubated ex vivo with cell trace far red-labelled live C. albicans for 3 h. TNF production in the monocytes/macrophages that interacted with live C. albicans was measured by flow cytometry. Dectin-1 KO and Dectin-2 KO monocytes/macrophages displayed reduced C. albicans-induced TNF production, while Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 cells displayed a more marked reduction in TNF production (Fig 5A and 5B and S7 Fig). The defect in TNF production appears to be independent of Mincle.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. CLR collaboration mediates C. albicans-induced cytokine/chemokine production from inflammatory monocytes/macrophages.

(A-D) WT and CLR KO mice were injected with BIOgel i.p. and inflammatory cells were recovered by peritoneal lavage after 16–18 h. (A-B) Cells were stimulated for 3 h with cell trace far red-labelled C. albicans at a 1:1 ratio in the presence of Brefeldin A. TNF levels were analysed by flow cytometry. Percentage Ly6G^-CD11b⁺ inflammatory monocytes/macrophages that produced TNF—isotype (A) and MFI TNF production—isotype (B) was measured by flow cytometry in inflammatory monocytes/macrophages that interacted with labelled C. albicans. TNF MFI for WT cells interacting with C. albicans was set at 100%. (A-B) n = 2–7 mice. Graphs show cumulative data from 5 independent experiments. (1-way ANOVA with Bonferroni’s post-test). (C-D) Ly6C^hi inflammatory monocytes were purified by cell sorting. Cells were stimulated with C. albicans at a ratio of 3:1 (Cells:Candida) for 3 h. RNA was extracted and RNAseq analysis was performed. Data shows the mean from two replicates each of WT and Min-D2-D1 and one replicate of D1D2 DKO cells. 177 protein coding transcripts that showed 10 or more reads and an adjusted p value of <0.05 (Benjamin-Hochberg correction for multiple testing) were selected from the RNAseq data. Following Z transformation across genes, genes were clustered by K means of FPKM values into 3 clusters using Genesis software (S8 Fig). (C) Genes from Cluster 1 are displayed. (D) Heatmap displays genes with the GO terms chemokine activity (GO:0008009), cytokine activity (GO:0005125) and growth factor activity (GO:0008083) for transcripts that showed 10 or more reads. (C-D) Data range -2.5 (blue) to +2.5 (yellow). Asterisks highlight the genes chosen for validation. (E) Bone marrow monocytes were bead purified from WT and Min-D2-D1 TKO1 mice and stimulated with C. albicans at a ratio of 1:1 for 24 h in the presence of Amphotericin B. Cytokines and chemokines in the supernatants were measured by ELISA. Graphs display cumulative data from 4 independent experiments. I = Interaction, T = Treatment, G = Genotype (matched 2-way ANOVA on transformed data).

https://doi.org/10.1371/journal.ppat.1007850.g005

We next examined whether CLRs collaborated to more broadly influence inflammatory monocyte gene expression. Thus, we stimulated BIOgel-elicited monocytes isolated from WT, Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 mice with C. albicans for 3 h and examined global gene expression using RNASeq analysis. We applied a filter to remove low expression transcripts (<10 reads) which revealed 177 significantly different (adjusted p value of <0.05) protein coding transcripts. Following Z transformation across genes, genes were clustered by K means into 3 clusters using Genesis software (S8 Fig). Cluster 1 consisted of genes that were higher basally and/or upregulated with C. albicans stimulation in WT cells compared to Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 cells (Fig 5C). Ingenuity Pathway Analysis (IPA) revealed that these genes are important for the inflammatory response, cellular movement and cell-to-cell signalling. As many of the genes in this cluster were chemokines, we searched for the GO terms chemokine activity (GO:0008009), cytokine activity (GO:0005125) and growth factor activity (GO:0008083) for transcripts that showed 10 or more reads (Fig 5D). Many of these genes were present or induced in WT cells by C. albicans while they were absent or not induced in Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 cells. The defect in the inflammatory response in Mincle-Dectin-2-Dectin-1 TKO1 monocytes was validated by ELISA measurement of chemokines and cytokines in cell supernatants 24 h after stimulation with C. albicans (Fig 5E). The ELISA results validated the findings in Fig 5C and 5D. These data indicate that Dectin-1 and Dectin-2 are vitally important for mediating C. albicans-induced chemokine and cytokine production from inflammatory monocytes.

Dectin-1 is important for early neutrophil recruitment

As C. albicans recognition and cytokine/chemokine production were highly defective in inflammatory monocytes and macrophages from multi-CLR KO mice, we hypothesised that early innate cell recruitment would be delayed in response to C. albicans. In addition, Taylor et al previously demonstrated that Dectin-1 KO mice displayed reduced inflammatory cell recruitment in response to C. albicans [14]. Using a peritoneal infection model, we therefore explored whether this defective inflammatory cell recruitment also occurred in the highly susceptible multi-CLR KO mice. We injected mice intraperitoneally with 1x10⁵ CFU C. albicans and 4 h later, we examined inflammatory cell recruitment to the peritoneum. In response to C. albicans, we observed reduced neutrophil recruitment to the peritoneum of Dectin-1 KO, Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 but not Dectin-2 KO mice (Fig 6A and 6B). These same mice also demonstrated reduced resident macrophage emigration (Fig 6A and 6B) and reduced levels of Ccl2 in the lavage fluid. These data confirm that Dectin-1 is highly important for early neutrophil recruitment to the C.albicans-infected peritoneum.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. Dectin-1 is important for early neutrophil recruitment.

(A-C) WT and CLR KO mice were injected with 1x10⁵ CFU C. albicans i.p. and inflammatory cells were recovered by peritoneal lavage after 4 h. (A-B) Percentage (A) and total number (B) of recruited neutrophils, Ly6⁺ monocytes and resident macrophages in the peritoneal lavages were measured by flow cytometry. (C) Chemokine and cytokine levels in the lavage fluid were measured by ELISA. (A-C) n = 6–12 mice. Graphs show cumulative data from 3 independent experiments. (1-way ANOVA with Bonferroni’s post-test–Performed on transformed data for total resident macrophages, G-CSF and IL-6; Kruskal-Wallis test with Dunn’s post-test for % Resident macrophages).

https://doi.org/10.1371/journal.ppat.1007850.g006

CLRs mediate the protective effect of inflammatory monocytes during infection with C. albicans

As we identified highly defective cytokine/chemokine responses by multi-CLR KO monocytes ex vivo (Fig 5) and reduced chemokine production and neutrophil recruitment in vivo (Fig 6), we wanted to further examine the role of these CLRs in monocytes in vivo. Ccr2⁺ Ly6C^hi inflammatory monocytes have been proposed to be important during the first 48 h of systemic infection with C. albicans and Ccr2 KO mice are highly susceptible to systemic C. albicans infection [39, 40]. To confirm the protective effect of Ccr2⁺ Ly6C^hi monocytes in our facility during systemic infection with C. albicans, we infected WT and Ccr2 KO mice intravenously with 1x10⁵ CFU C. albicans SC5314. Similar to previous findings, we observed increased fungal burden in the kidneys of Ccr2 KO mice (Fig 7A). As inflammatory monocytes from Dectin-1-Dectin-2 DKO and Mincle-Dectin-2-Dectin-1 TKO1 mice display severely deficient responses (Figs 3–5) and these mice are highly susceptible to systemic C. albicans infection (Fig 1), we performed adoptive transfer experiments to determine whether these CLRs are responsible for the protective effect of monocytes during C. albicans infection (Fig 7B). Since Mincle was involved in recognition of C. albicans by inflammatory monocytes, we adoptively transferred Ly6C^hi monocytes from Mincle-Dectin-2-Dectin-1 TKO1 mice. We found that Ccr2 KO mice that received Ly6C^hi monocytes from WT mice displayed lower kidney fungal burden than mice that received Ly6C^hi monocytes from TKO1 mice, 72 h post-infection (Fig 7C). We then performed further adoptive transfer experiments to examine cell recruitment to the kidney, 24 h post-infection. We found significantly reduced numbers of adoptively transferred Mincle-Dectin-2-Dectin-1 TKO1 monocytes than WT monocytes in the kidneys of infected mice (Fig 7D and 7E). We also observed a subtle reduction in neutrophil recruitment to the kidneys (Fig 7D and 7E) and Cxcl2 production in the kidneys (Fig 7F) of mice who received Mincle-Dectin-2-Dectin-1 TKO1 monocytes compared to WT monocytes. These data indicate that these receptors mediate the protective effect of inflammatory monocytes during systemic infection with C. albicans.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 7. CLR collaboration is responsible for the protective effect of inflammatory monocytes during infection with C. albicans.

(A) Quantification of fungal burden in the kidneys (left) or brains (right) of WT and Ccr2 KO mice 2 days after intravenous infection with 1x10⁴ CFU C. albicans. Graphs display cumulative data from 2 independent experiments. Each symbol represents one mouse. (Student’s t test on transformed data). (B) Protocol of WT or Min-D2-D1 TKO1 monocyte transfer and C. albicans infection in Ccr2 KO mice. (C) 3-4x10⁶ purified Ly6C^hi monocytes from WT or Min-D2-D1 TKO1 mice were adoptively transferred to Ccr2 KO mice followed by intravenous injection with 1.5x10⁴ CFU C. albicans. Organs were harvested after 72 h and fungal burden was determined. Graphs display cumulative data from 3 independent experiments. Each symbol represents one mouse. (Student’s paired t test). (D-F) 2.5x10⁶ purified monocytes from WT or Min-D2-D1 TKO1 mice were adoptively transferred to Ccr2 KO mice followed by intravenous injection with 1.5x10⁴ CFU C. albicans. (D-E) Kidneys were harvested after 24 h and myeloid cell recruitment to the kidneys was determined by flow cytometry. (F) Fungal burden and chemokine/cytokine production in the kidneys was determined. Graphs display cumulative data from 3 independent experiments. Each symbol represents one mouse. (Student’s t test).

https://doi.org/10.1371/journal.ppat.1007850.g007